|  Help  |  About  |  Contact Us

Allele : Fyco1<em1(IMPC)J> FYVE and coiled-coil domain containing 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6117089 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Fyco1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACAAAACCAGTGCATGACAG, GTGCTTTCCGAACCACACCC, GGACATTCAACTATTCAGGT and TAAGATGCGTGTCAATTCTA, which resulted in a 376 bp deletion beginning at Chromosome 9 negative strand position 123,840,459 bp and ending after 123,840,834 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000149201 (exon 4) and 269 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 18 and early truncation 1 amino acid later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories