|  Help  |  About  |  Contact Us

Allele : Dnajb5<em1(IMPC)J> DnaJ heat shock protein family (Hsp40) member B5; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6117091 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dnajb5
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCATTTAGTGGCAGAGGGAA, CCTTTCTTATTCTGTCAGCG, ATGTACACGGGAAAAGACCA and ACACGGGAAAAGACCATGGC, which resulted in a 775 bp deletion beginning at Chromosome 4 positive strand position 42,956,466 bp and ending after 42,957,240 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001313254 (exon 3) and 173 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 11 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories