| Primary Identifier | MGI:5927761 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cacng6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCAAGAGGAAGACCGACGC, AGACCGACGCCGGACAGCTG, GGCGGATGTGCCCGCGGGCA and TGGCAGGCGGATGTGCCCGC, which resulted in a 311 bp internal deletion beginning at Chromosome 7 negative strand position 3,424,975 bp and ending after 3,424,665 bp (GRCm38/mm10). This mutation deletes 311 bp of ENSMUSE00001284940 (exon 1) and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 1 amino acid later. |