|  Help  |  About  |  Contact Us

Allele : Cacng6<em1(IMPC)J> calcium channel, voltage-dependent, gamma subunit 6; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5927761 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cacng6
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCAAGAGGAAGACCGACGC, AGACCGACGCCGGACAGCTG, GGCGGATGTGCCCGCGGGCA and TGGCAGGCGGATGTGCCCGC, which resulted in a 311 bp internal deletion beginning at Chromosome 7 negative strand position 3,424,975 bp and ending after 3,424,665 bp (GRCm38/mm10). This mutation deletes 311 bp of ENSMUSE00001284940 (exon 1) and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 1 amino acid later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele