| Primary Identifier | MGI:5927763 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Kcna6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGATGCTCACCGAGGTTTGA, ATCGAGCTTATGCGGAGAAA, ATCGGAGAAATCCCTGACGC and GGAGAAATCCCTGACGCTGG, which resulted in an internal deletion beginning at Chromosome 6 negative strand position 126,739,902 bp and ending after 126,738,338 bp (GRCm38/mm10). This mutation deletes 1565 bp of ENSMUSE00000690877 (exon 1) and is predicted to cause a change of amino acid sequence after residue 7 with read through the stop to generate a later stop 54 amino acids later. |
