| Primary Identifier | MGI:6094268 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Trf |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTCAAACCAGAGGCGTATAG, GCAGGAAGAGGATCATTCCA, GCATCTCTCTAAGCAGCCCA and GATGAATCCGTTCGCCCCAA, which resulted in a 426 bp deletion beginning at Chromosome 9 negative strand position 103,228,289 bp and ending after 103,227,864 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001246941 (exon 2) and 253 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 1 amino acids later. |
