| Primary Identifier | MGI:5927700 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Impg1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCAATATCCTAGGAGCAGCA, CCTTAGTAACCATTTCAAAG, TTAAAGTTAGCCATGCAAAA and ATTAGTGTGTGAACATAAGC, which resulted in a 312 bp deletion beginning at Chromosome 9 negative strand position 80,435,559 bp and ending after 80,435,248 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000694908 (exon 3) and 145 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 99 and early truncation 12 amino acids later. |
