|  Help  |  About  |  Contact Us

Allele : Brms1l<em1(IMPC)J> breast cancer metastasis-suppressor 1-like; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5927711 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Brms1l
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences AATATGAAACTGGACATCCA, CCACTGAGATTCAGTGACGA and TGAGGCCAGTGAGGTTTTGG, which resulted in a 562 bp deletion beginning at Chromosome 12 positive strand position 55,841,295 bp and ending after 55,841,856 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000654815 (exon 2) and 471 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp (G) insertion at the deletion site, which will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 47 and early truncation 6 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories