|  Help  |  About  |  Contact Us

Allele : Clrn3<em1(IMPC)J> clarin 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6094836 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Clrn3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATACCTGGAATGGACTCAG, ATGGGTGTCTATACCTGGAA, CACCAGGTGCAAAGACTTCT and CCAGAAGTCTTTGCACCTGG, which resulted in a 157 bp deletion beginning at Chromosome 7 negative strand position 135,518,605 bp and ending after 135,518,449 bp (GRCm38/mm10). This mutation creates an internal deletion of ENSMUSE00000341796 (exon 2) and is predicted to cause a change of amino acid sequence after residue 84 and a stop 108 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories