| Primary Identifier | MGI:6158647 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pus1 |
| Inheritance Mode | Not Specified | Strain of Origin | Not Specified |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences GTACTGTTCTAATAGTATGT and ACTTTAGGACCAGGGTGTGA, which resulted in a 340 bp deletion beginning at Chromosome 5 position 110,775,367 bp and ending after 110,775,706 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001374264 (exon 5) and 237 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 151 and early truncation 1 amino acid later. |
