|  Help  |  About  |  Contact Us

Allele : Pus1<em1(IMPC)J> pseudouridine synthase 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6158647 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pus1
Inheritance Mode  Not Specified Strain of Origin  Not Specified
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences GTACTGTTCTAATAGTATGT and ACTTTAGGACCAGGGTGTGA, which resulted in a 340 bp deletion beginning at Chromosome 5 position 110,775,367 bp and ending after 110,775,706 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001374264 (exon 5) and 237 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 151 and early truncation 1 amino acid later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele