|  Help  |  About  |  Contact Us

Allele : Igsf9<em1(IMPC)J> immunoglobulin superfamily, member 9; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6101173 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Igsf9
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTTGGCCCATGACTACAAA, GAGAAACTGTATGTGCGGGA, CTGAGTTTAATTCAGCGCTG and CCAGTGTTAGGCAGTGACTG, which resulted in a 1163 bp deletion beginning at Chromosome 1 positive strand position 172,491,340 bp and ending after 172,492,502 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000361352 through ENSMUSE00000366373 (exons 7-9) and 590 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 224 and early truncation 18 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories