| Primary Identifier | MGI:6111949 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dguok |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTTGGGAAACCACAAAGAC, AGACATGCACGCAGTCTAAT, GCAGCCAGTAACTTCTGCCA and TGCTTCCCAAATCCAGGTGA, which resulted in a 377 bp deletion retention of 3 bp (CAA)of endogenous sequence and further deletion of 26 bp, beginning at Chromosome 6 negative strand position 83,496,866 bp and ending after 83,496,461 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001273030 (exon 2) and 290 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 47 and early truncation 55 amino acids later. |
