| Primary Identifier | MGI:6111956 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cep95 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTTGTCTCTTCTTCTCCAA, CCCCAAAGTGTGCAAACAGG, GGAAAGTCAAGAGCTCAGAA and GGAGGGACATTAGAGTATGC, which resulted in a 404 bp deletion beginning at Chromosome 11 positive strand position 106,799,857 bp and ending after 106,800,260 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000108594 (exon 5) and 304 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 123 and early truncation 22 amino acids later. |
