| Primary Identifier | MGI:6158930 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Frmd4a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTAAGTCACGTCATCATCTT, GCCACTCCAGGCATGATCAC, TGCAGTGTGCCTGAGTTCTC and TAGCCCCCATGGGACCCAAG, which resulted in a 354 bp deletion beginning at Chromosome 2 position 4,473,021 bp and ending after 4,473,374 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001239970 (exon 3) and 259 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 22 and early truncation 15 amino acids later. |
