| Primary Identifier | MGI:6140119 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dipk2b |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at UC Davis by injecting CAS9 Protein and 2 guide sequences CCCCCCAATGTACAGAAGGGTCA, TGGAAGGGTCCCCAAAGGAGTGG, which resulted in a Exon Deletion. |