| Primary Identifier | MGI:6111974 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Itfg2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTTCCTGGGCAGACCCCA, AACACTGCACATGTGCACCA, GGTTTGTCCATATAGCAAAG and TCGAGATGAATGTTCTCTCT, which resulted in a 507 bp deletion beginning at Chromosome 6 negative strand position 128,416,346 bp and ending after 128,415,840 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001296813 and ENSMUSE00001250898 (exons 3 and 4) and 296 bp of flanking intronic sequence including the splice acceptors and donors. In addition, there are 2 small intronic indels, a 1 bp (G) deletion 108 bp before the exon deletion and a 2 bp deletion (GT) 62 bp after the deletion that will not alter the results of the exons being deleted. This mutation is predicted to cause a change of amino acid sequence after residue 64 and early truncation 9 amino acids later. |
