| Primary Identifier | MGI:6104246 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tsga13 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAAGTTGAGGCGGTAACAA, TCCCAAGGAAAGATGACATA, GTTAAGTTCCCAAACTTAAA and CCTTTCCTCAACACGCAAGA, which resulted in a 357 bp deletion beginning at Chromosome 6 negative strand position 30,912,374 bp and ending after 30,912,018 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000289889 (exon 2) and 275 bp of flanking intronic sequence including the splice acceptor and donor. In addition, 64 bp before the exon deletion there is an indel consisting of a 4 bp insertion, ATAT, and a 7 bp deletion, CGCAAGA, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 8 and early truncation 11 amino acids later. |
