|  Help  |  About  |  Contact Us

Allele : Tsga13<em1(IMPC)J> testis specific gene A13; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6104246 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tsga13
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAAGTTGAGGCGGTAACAA, TCCCAAGGAAAGATGACATA, GTTAAGTTCCCAAACTTAAA and CCTTTCCTCAACACGCAAGA, which resulted in a 357 bp deletion beginning at Chromosome 6 negative strand position 30,912,374 bp and ending after 30,912,018 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000289889 (exon 2) and 275 bp of flanking intronic sequence including the splice acceptor and donor. In addition, 64 bp before the exon deletion there is an indel consisting of a 4 bp insertion, ATAT, and a 7 bp deletion, CGCAAGA, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 8 and early truncation 11 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele