| Primary Identifier | MGI:6104257 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rbm6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTTATTTGAAGGCACCAAC, TATGGCTCTTTGTCCACACA, CCAGCTGGCCAAGAATCACA and CTAATTTTTTATTTCCCTAC, which resulted in a 468 bp deletion beginning at Chromosome 9 negative strand position 107,847,543 bp and ending after 107,847,076 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001305293 (exon 5) and 398 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 471 and early truncation 27 amino acids later. |
