|  Help  |  About  |  Contact Us

Allele : Zpld1<em1(IMPC)J> zona pellucida like domain containing 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6108892 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zpld1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGCTGCTTAGAGGACCATAG, TGGTTCTGTTGATAGGAGCT, AGTGTGCACGTTATTAAGAG and ATAAAAGCACAGTAGAGGGC, which resulted in a 477 bp deletion beginning at Chromosome 16 negative strand position 55,251,842 bp and ending after 55,251,366 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000223414 (exon 4) and 256 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 10 bp deletion (CTATGGTCCT) 26 bp after the large deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 35 and early truncation 25 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories