| Primary Identifier | MGI:6108892 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zpld1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGCTGCTTAGAGGACCATAG, TGGTTCTGTTGATAGGAGCT, AGTGTGCACGTTATTAAGAG and ATAAAAGCACAGTAGAGGGC, which resulted in a 477 bp deletion beginning at Chromosome 16 negative strand position 55,251,842 bp and ending after 55,251,366 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000223414 (exon 4) and 256 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 10 bp deletion (CTATGGTCCT) 26 bp after the large deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 35 and early truncation 25 amino acids later. |
