|  Help  |  About  |  Contact Us

Allele : Il2ra<em1Mson> interleukin 2 receptor, alpha chain; endonuclease-mediated mutation 1, Alexander Marson

Primary Identifier  MGI:6110563 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Il2ra
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 technology inserted an Il2ra intron 1 enhancer region guide RNA and Cas9 mRNA. The gRNA carries a C to T mutation associated with human inflammatory bowel disease (GAAGGAGGTATCTATTTTGGTCCC to GAAGGAGGTATTTATTTTGGTCCC) and Type 1 Diabetes (T1D). Expression of the Il2ra gene is not blocked, but in vitro gene activation in response to cell stimulation with anti-CD3/CD28 antibodies is delayed.
  • mutations:
  • Single point mutation,
  • Insertion
  • synonyms:
  • SNP,
  • SNP
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories