| Primary Identifier | MGI:6110563 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Il2ra |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 technology inserted an Il2ra intron 1 enhancer region guide RNA and Cas9 mRNA. The gRNA carries a C to T mutation associated with human inflammatory bowel disease (GAAGGAGGTATCTATTTTGGTCCC to GAAGGAGGTATTTATTTTGGTCCC) and Type 1 Diabetes (T1D). Expression of the Il2ra gene is not blocked, but in vitro gene activation in response to cell stimulation with anti-CD3/CD28 antibodies is delayed. |