| Primary Identifier | MGI:6107624 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc9a5 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTAGGAGGGGGCCATACGG, TTCCTCCTAGTCCCCTGGGG, TTGAATGCAGGCCAAGTTGG and GCCTCCTCTGTCCCAAACGC, which resulted in a 205 bp deletion beginning at Chromosome 8 positive strand position 105,355,428 bp and ending after 105,355,632 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000355153 (exon 4) and 126 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp insertion (AG) at the deletion site that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 221 and early truncation 14 amino acids later. |