|  Help  |  About  |  Contact Us

Allele : Spata3<em1(IMPC)J> spermatogenesis associated 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6107629 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Spata3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGATTCTAGCAGGTGTTGTA, GTGTCCCACTCCCAAGAACC, TTACAATGGGCTGGGTGGGA and GAGTTTACAATGGGCTGGGT, which resulted in a 531 bp deletion beginning at Chromosome 1 positive strand position 86,024,199 bp and ending after 86,024,729 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000695237 (exon 4) and 356 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an indel with an 8bp insertion (GGTTTTTT) and a 10 bp deletion (TGTCTATTTA) 85 bp after the 531 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 100 and truncation 38 amino acids later by read through of the stop codon into the 3 untranslated sequence.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories