| Primary Identifier | MGI:6114795 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Atp11c |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAAGCTGGTAAATAAGCAG, TATAAGCTGTTCTTATTCCA, TGCCTCAAAAGGATTTCAAA and GCGAATATTACAAATGTTGA, which resulted in a 442 bp deletion beginning at Chromosome X negative strand position 60,295,494 bp and ending after 60,295,053 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001283081 (exon 7) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 185 and early truncation 8 amino acids later. |
