| Primary Identifier | MGI:6114754 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc36a2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTAGCAGTCAGTGCTTGG, GTAAAGGTAGACTGGGTAAC, CAGCACTTCAATTACCTGCG and AGGATACAGGAAAATCGAGA, which resulted in a 479 bp deletion beginning at Chromosome 11 negative strand position 55,181,761 bp and ending after 55,181,283 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001295210 (exon 2) and 388 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 7 amino acids later. |
