| Primary Identifier | MGI:6119459 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | H2-K1 |
| Inheritance Mode | Not Specified | Strain of Origin | NOD/ShiLtDvs |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | This single nucleotide (G) deletion within exon 2 was shown by flow cytometry to cause a null allele. it was generated by injection of Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1b and ATAATCCGAGATTTGAGCCG targeting H2-K1d into NOD/ShiLtDvs embryos, which resulted in this point deletion and the intragenic deletions of H2-D1em5Dvs. |
