|  Help  |  About  |  Contact Us

Allele : H2-K1<d-em1Dvs> histocompatibility 2, K1, K region; endonuclease-mediated mutation 1, David V Serreze

Primary Identifier  MGI:6119459 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  H2-K1
Inheritance Mode  Not Specified Strain of Origin  NOD/ShiLtDvs
Is Recombinase  false Is Wild Type  false
molecularNote  This single nucleotide (G) deletion within exon 2 was shown by flow cytometry to cause a null allele. it was generated by injection of Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1b and ATAATCCGAGATTTGAGCCG targeting H2-K1d into NOD/ShiLtDvs embryos, which resulted in this point deletion and the intragenic deletions of H2-D1em5Dvs.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • H2-K1<em1Dvs>,
  • H2-K1<em1Dvs>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

10 Carried By

Trail: Allele

0 Driven By

6 Publication categories

Trail: Allele