| Primary Identifier | MGI:6120515 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tomm20 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporation of Cas9 protein and 4 guide sequences CTAACAGAGCTTCTCAAACT, TTTGCTCTTACCACCACCAA, GTTCACTCGCCAGGGAGGCA and ACGTTTTGTAGAATTAATGA, which resulted in a 396 bp deletion beginning at Chromosome 8 position 126,940,940 bp and ending after 126,941,335 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000480474 (exon 2) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 2 amino acids later. |