|  Help  |  About  |  Contact Us

Allele : Tubb4b<em1(IMPC)J> tubulin, beta 4B class IVB; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6120520 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tubb4b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCTTCCTTAATAGCCACC, AGGAAGGTCCAACTGACTGC, CCAGGGCGACGAATCCCTAA and GGTATCCAGGACGCAATGAA, which resulted in a 742 bp deletion beginning at Chromosome 2 position 25,223,727 bp and ending after 25,224,468 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000569385, ENSMUSE00000569384 (exons 3 and 4) and 522 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp insertion, GC, at the site of the deletion which will not alter the results of the 742 bp deletion. This deletion is predicted to cause a change of amino acid sequence after residue 19 and early truncation 27 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories