| Primary Identifier | MGI:6120520 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tubb4b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCTTCCTTAATAGCCACC, AGGAAGGTCCAACTGACTGC, CCAGGGCGACGAATCCCTAA and GGTATCCAGGACGCAATGAA, which resulted in a 742 bp deletion beginning at Chromosome 2 position 25,223,727 bp and ending after 25,224,468 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000569385, ENSMUSE00000569384 (exons 3 and 4) and 522 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp insertion, GC, at the site of the deletion which will not alter the results of the 742 bp deletion. This deletion is predicted to cause a change of amino acid sequence after residue 19 and early truncation 27 amino acids later. |
