|  Help  |  About  |  Contact Us

Allele : Pcdhgb1<em1(IMPC)J> protocadherin gamma subfamily B, 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6120529 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pcdhgb1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporation of Cas9 protein and 4 guide sequences TGGTCAACAGCGTCGCCTAA, ATTATCCTTCCCAATTCACA, GTGTGGCTAGCAAATCTTGC and TTTAGTGGAAGACGTGTCGT, which resulted in a 3032 bp deletion beginning at Chromosome 18 position 37,680,029 bp and ending after 37,683,060 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001339721 (exon 1) and 425 bp of flanking intronic sequence including the Kozak sequence and splice donor and is predicted to cause a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories