| Primary Identifier | MGI:6120529 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pcdhgb1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporation of Cas9 protein and 4 guide sequences TGGTCAACAGCGTCGCCTAA, ATTATCCTTCCCAATTCACA, GTGTGGCTAGCAAATCTTGC and TTTAGTGGAAGACGTGTCGT, which resulted in a 3032 bp deletion beginning at Chromosome 18 position 37,680,029 bp and ending after 37,683,060 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001339721 (exon 1) and 425 bp of flanking intronic sequence including the Kozak sequence and splice donor and is predicted to cause a null allele. |