|  Help  |  About  |  Contact Us

Allele : Ecpas<em1(IMPC)J> Ecm29 proteasome adaptor and scaffold; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6147390 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ecpas
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGATGGGAACAGGTAAGCG, GCTTGGGCTTGTTTACCTGA, TTGGAAGCTGTAATAAACAG and ACATGTCAATTACTACTGCT, which resulted in a 289 bp deletion beginning at Chromosome 4 position 58,876,921 bp and ending after 58,877,209 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000527161 (exon 4) and 170 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp insertion (GAAT) and a 6 bp deletion (TAAACA)47 bp before the 289 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 90 and early truncation 16 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories