| Primary Identifier | MGI:6147390 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ecpas |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGATGGGAACAGGTAAGCG, GCTTGGGCTTGTTTACCTGA, TTGGAAGCTGTAATAAACAG and ACATGTCAATTACTACTGCT, which resulted in a 289 bp deletion beginning at Chromosome 4 position 58,876,921 bp and ending after 58,877,209 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000527161 (exon 4) and 170 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp insertion (GAAT) and a 6 bp deletion (TAAACA)47 bp before the 289 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 90 and early truncation 16 amino acids later. |
