|  Help  |  About  |  Contact Us

Allele : Hnrnph2<em1(IMPC)J> heterogeneous nuclear ribonucleoprotein H2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6147827 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Hnrnph2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences CACCATGATGCTGAGCACAG and TTGAGTTTTCCTGAAGAACT which resulted in a 1451 bp deletion beginning at Chromosome X position 134,604,908 bp and ending after 134,606,358 bp (GRCm38/mm10). This mutation deletes most of the coding sequence of ENSMUSE00000653740 (exon 4) leaving 53 bp of 5' UTR with the deletion beginning just before the ATG and ending in the 3' UTR 100 bp after the TAA stop. This is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories