|  Help  |  About  |  Contact Us

Allele : Slc22a17<em1(IMPC)H> solute carrier family 22 (organic cation transporter), member 17; endonuclease-mediated mutation 2, Harwell

Primary Identifier  MGI:6144258 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Slc22a17
Strain of Origin  C57BL/6NTac Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences GATGTATGAGGGTAAGATGCAGG, TACTTCAAAGCTGATGTATGAGG, CCCTGCCTAGACCCTTTAAAAGG, CAGCTGAAATCTGGGACCTAGGG, which resulted in a 400-bp exon deletion, including a critical exon to generate a knock-out.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories