|  Help  |  About  |  Contact Us

Allele : C2cd4a<em1(IMPC)H> C2 calcium-dependent domain containing 4A; endonuclease-mediated mutation 1, Harwell

Primary Identifier  MGI:6144265 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  C2cd4a
Strain of Origin  C57BL/6NTac Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCAAGAGGCGCTTTGCTTTGATC, GACAGTAACTATTTTCCAGTTGG, CCTCTGTCCCTAGTTCCAAGAGG, CCAGTTGGAATGTGTGAACAGAT, which resulted in a Exon Deletion.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • C2cd4a-Del1724-EM1-B6N,
  • C2cd4a-Del1724-EM1-B6N
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories