| Primary Identifier | MGI:6149747 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cep350 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTGAGTTGATAGGTAGGG, AGACACTGCAGTAGGGTCTC, GGATACTCAGTTCACACCGA and GCATTGGATAAGGGCTGAAG, which resulted in a 392 bp deletion beginning at Chromosome 1 position 155,960,980 bp and ending after 155,961,371 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000537328 (exon 3) and 348 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a small indel, a 1 bp (T) insertion and 4 bp (GGTA) deletion, 88 bp after the 392 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 24 and early truncation 4 amino acids later. |
