|  Help  |  About  |  Contact Us

Allele : Pmpca<em1(IMPC)J> peptidase (mitochondrial processing) alpha; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6149992 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pmpca
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGTTCTCCTCTCTTCACAG, CAGCTGGTCTAAATGAAGAC, GAAGGGCTATAACTTCCTGT and ATGGCATTCATGCTTACACA, which resulted in a 525 bp deletion beginning at Chromosome 2 position 26,390,877 bp and ending after 26,391,401 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000164354 (exon 5) and 430 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid residue 145.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories