| Primary Identifier | MGI:6151421 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cherp |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCTGTTGCCAAATTCTATA, CCATTCTTAATGAGTAGGGA, CATCAGGTCCTCTCTCTGGA and CAGTGAGATCAAGCACAACA, which resulted in a 525 bp deletion beginning at Chromosome 8 position 72,470,672 bp and ending after 72,471,196 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000463654 (exon 3) and 340 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp insertion (CT) at the deletion site. This deletion is predicted to cause a change of amino acid sequence after residue 66 and early truncation 29 amino acids later. |
