| Primary Identifier | MGI:6151442 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Emilin2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences TGGTGTTGTTACCAAGGACA and GGAGACTCTCTTAAAACTAG, which resulted in a 300 bp deletion beginning at Chromosome 17 position 71,280,606 bp and ending after 71,280,905 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000235473 (exon 3) and 124 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 6 bp insertion (TCTAAG) at the deletion site, that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 91 and early truncation 7 amino acids later. |
