|  Help  |  About  |  Contact Us

Allele : Rr170<tm3.1Iku> regulatory region 170; targeted mutation 3.1, Koichi Ikuta

Primary Identifier  MGI:6151129 Allele Type  Targeted
Attribute String  Modified regulatory region Gene  Rr170
Transmission  Germline Strain of Origin  (C57BL/6J x 129S6/SvEvTac)F1
Is Recombinase  false Is Wild Type  false
molecularNote  Mice harboring point mutations in one of the two glucocorticoid response elements (GREs) in the Il7r enhancer (upstream of the gene) were generated. The sequence mutated is in the first element (GRE1) as follows: GRE1 wild-type, CTTTGTTCTTTTACATCTTCA; GRE1m, CTTcacTgcTTTgagTgcTCA. A targeting construct containing the mutations and a loxP site flanked neomycin selection cassette was used to create mutant ES cells via homologous recombination. The neo cassette was removed through subsequent cre-mediated recombination.
  • mutations:
  • Single point mutation
  • synonyms:
  • Il7r<tm3.1Iku>,
  • Il7rCNS1.GRE1m,
  • Il7rCNS1.GRE1m,
  • Il7r<tm3.1Iku>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories