|  Help  |  About  |  Contact Us

Allele : Rbbp4<em1(IMPC)Mbp> retinoblastoma binding protein 4, chromatin remodeling factor; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis

Primary Identifier  MGI:6152622 Allele Type  Endonuclease-mediated
Gene  Rbbp4 Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from IMPC was generated at UC Davis by injecting CAS9 RNA and 4 guide sequences TGAGTTCAATATGGTGCTAGGGG, TGTACCTGGAAAAAACCTAGGGG, CCAGAGGACAATTAGTCATCACT, CCTTAAGTTCAAGCACAGGAACA, which resulted in an Exon Deletion. Exon 3 (ENSMUSE00001236831) and flanking splicing regions were deleted. RT-PCR analysis confirmed the absence of Rbbp4 expression in homozygous mutant blastocysts.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Rbbp4<->,
  • Rbbp4<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

9 Publication categories