| Primary Identifier | MGI:6152622 | Allele Type | Endonuclease-mediated |
| Gene | Rbbp4 | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at UC Davis by injecting CAS9 RNA and 4 guide sequences TGAGTTCAATATGGTGCTAGGGG, TGTACCTGGAAAAAACCTAGGGG, CCAGAGGACAATTAGTCATCACT, CCTTAAGTTCAAGCACAGGAACA, which resulted in an Exon Deletion. Exon 3 (ENSMUSE00001236831) and flanking splicing regions were deleted. RT-PCR analysis confirmed the absence of Rbbp4 expression in homozygous mutant blastocysts. |
