| Primary Identifier | MGI:6152686 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zc3h4 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at UC Davis by injecting CAS9 Protein and 3 guide sequences GTCTGCTATGGCTACCAAGGAGG, CCTCCACTCCTGGACTTTCATCA, GTAGATAACTACGATACGGGAGG, which resulted in an Exon Deletion. The entire exon 4 (ENSMUSE00000895527, 223 bp) was deleted generating a frame-shifted knockout allele. |
