| Primary Identifier | MGI:6153864 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tspoap1 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 2 guide sequences GAAGCGGAAGAATGCTGAACTGG, CCAGAGACGGAGGAGAAGGTACG, which resulted in a Indel. |