|  Help  |  About  |  Contact Us

Allele : Tspoap1<em1(IMPC)H> TSPO associated protein 1; endonuclease-mediated mutation 1, Harwell

Primary Identifier  MGI:6153864 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tspoap1
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 2 guide sequences GAAGCGGAAGAATGCTGAACTGG, CCAGAGACGGAGGAGAAGGTACG, which resulted in a Indel.
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele