| Primary Identifier | MGI:6153616 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sike1 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences CCAGCTGTTAGGAGGTTTGCCTT, CCAGTCTTAGACGTCATTGTCCA, CCTCTTCCATCCTTTAGTGGTCA, GTCAAGTTACCTCCCTCACCAGG, which resulted in a Exon Deletion. |
