|  Help  |  About  |  Contact Us

Allele : Herc1<em3(IMPC)Wtsi> HECT and RLD domain containing E3 ubiquitin protein ligase family member 1; endonuclease-mediated mutation 3, Wellcome Trust Sanger Institute

Primary Identifier  MGI:6153732 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Herc1
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  CRISPR/Cas9 genome editing technology was used to generate a 191 bp deletion that included exon 8 of the gene. This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences CCATGTATGTAGGCAAACTTGGC, TGTTAATGTCTTCTGCTATCAGG, CAACAGGGCAGGTAAGACGAAGG, TAAGAGTATTTCAGTGGACTAGG.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

7 Publication categories